Asian Journal of Transfusion Science
Home About Journal Editorial Board Search Current Issue Ahead of print Back Issues Instructions Subscribe Login  Users: 165 Print this page  Email this page Small font sizeDefault font sizeIncrease font size 

CASE REPORT Table of Contents   
Year : 2019  |  Volume : 13  |  Issue : 2  |  Page : 129-131
Detection of a rare subgroup of A phenotype while resolving ABO discrepancy

1 Department of Transfusion Medicine, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Trivandrum, Kerala, India
2 Department of Transfusion Medicine, National Institute of Immunohaematology, Mumbai, Maharashtra, India

Click here for correspondence address and email

Date of Submission08-Sep-2017
Date of Acceptance08-Jan-2018
Date of Web Publication3-Dec-2019


Weaker subgroups of ABO blood group system give rise to discrepancies between forward and reverse grouping and cause diagnostic difficulties in routine blood banking. Weaker subgroups of A blood group that have been reported so far include A3, Aend, Ax, Am, Ay, and Ael. We report a case of a 54-year-old patient whose red cells showed a discrepancy between cell and serum grouping on initial testing. Serological investigation included absorption elution tests and saliva testing after performing initial blood grouping. Molecular genotyping of the ABO gene was performed by DNA sequencing of exons 6 and 7 of the ABO gene. The serological characteristics of the patient's red cells were similar to Ax subtype. The patient was a secretor and only H substance was present in the saliva. Serum did not show the presence of anti-A1. Molecular genotyping confirmed the ABO status as Aw06/O13. The weak A phenotype identified in the propositus had serological characteristics similar to Ax and showed the ABO genotype Aw06/O13. Although Aw06 allele has been previously reported in the Indian population, this is the first study to report O13 allele in the Indian population.

Keywords: Aw06, Ax, O13, subgroup, weaker variants

How to cite this article:
Nair R, Gogri H, Kulkarni S, Gupta D. Detection of a rare subgroup of A phenotype while resolving ABO discrepancy. Asian J Transfus Sci 2019;13:129-31

How to cite this URL:
Nair R, Gogri H, Kulkarni S, Gupta D. Detection of a rare subgroup of A phenotype while resolving ABO discrepancy. Asian J Transfus Sci [serial online] 2019 [cited 2020 Mar 29];13:129-31. Available from:

   Introduction Top

Due to their immunogenicity, the ABO antigens are of prime importance in blood transfusions, hemolytic disease of the fetus and newborn due to ABO incompatibility, and organ transplantation. Correct typing of ABO blood groups of blood donors and recipients is therefore essential. The antigens are encoded by the ABO gene which is located on chromosome 9. It consists of seven exons and six introns. The three main alleles encoded by this gene are A, B, and O.[1]

ABO antigens are routinely detected using hemagglutination-based methods. The presence of weaker subgroups of A and B gives rise to discrepancy in cell and serum grouping. Weaker subgroups of A are defined as those Group A participants whose erythrocytes give weaker reactions or are nonreactive serologically with anti-A antisera than A2 RBCs.[2] These weak phenotypes, in majority of cases, result from expression of a variant A allele present at the ABO loci. These can be divided into two categories depending on whether the cells are agglutinated with anti A-A3, Aend, and Ax are agglutinated, while Am, Ay, and Ael cells are not. The above weaker phenotypes can be serologically differentiated from each other using the following techniques:[3]

  1. Cell grouping using anti-A, anti-B, anti-A, B, and anti-H and serum grouping to detect ABO antibodies
  2. Testing with different batches of anti-A reagent
  3. Adsorption-elution experiments with polyclonal anti-A and anti-A + B from Group B and Group O individuals, respectively
  4. Secretor status for the presence of H and/or A antigen in saliva
  5. Molecular genotyping of ABO gene, especially exons 6 and 7 as they encode for 77% of glycosyltransferase activity.

The weak A phenotype identified in the present case had serological characteristics similar to Ax blood type and showed the ABO genotype Aw06/O13. Although Aw06 allele has been previously reported in the Indian population, this is the first study to report O13 allele in the Indian population.

   Case Report Top

A 54-year-old gentleman was admitted in the cardiology intensive care unit for angioplasty. Blood sample was sent to the blood center for ABO grouping and Rh typing. Discrepancy was observed in cell and serum grouping. The patient's red cells were nonreactive with anti-A, anti-B, and anti-A1. However, it showed weak reaction with anti-A, B and strong agglutination reaction with anti-H (++++). The patient's serum showed the presence of anti-B antibody [Table 1]. Blood grouping pattern observed was suggestive of the presence of weaker subgroup of A, indicating type II discrepancy.[1]
Table 1: Serological and molecular findings observed on testing the patient

Click here to view

Blood grouping was repeated and technical errors were ruled out. To detect the presence of weak A antigen, heat elution was performed on the patient's red cells. The eluate showed microscopic agglutination with three different A group cells. To detect the presence of soluble substances, secretor status was determined using patient's saliva. The patient was found to be a secretor, having only H substance detectable in the saliva. These serological reactions obtained were consistent with reactivity pattern of Ax subtype. Molecular genotyping of the ABO gene was carried out by DNA sequencing of fragments specific for exons 6 (479 bp) and 7 (975 bp) as described by Cai et al.[4] Briefly, exons 6 and 7 were amplified using the following polymerase chain reaction (PCR) program: an initial denaturation of 3 min at 95°C; 30 amplification cycles consisting of 30 s at 95°C, 30 s at 56°C, and − 30°C to 60 s at 72°C; and then, a final extension step of 8 min at 72°C. The primer sequences are: For exon 6: Forward primer 5' tggaagggtggtcagagga3' and reverse primer 5'ctggagaaggagctgggtt 3' and For Exon 7: 5' tgggaagaggatgaagtgaat 3' and reverse primer 5' caacaggacggacaaagga 3'. The PCR products were then purified from agarose gel using a gel extraction kit (Biobasic) and subsequently sequenced on the ABI Prism 310 Genetic Analyzer (Applied Biosystem, CA, USA). The data were analyzed using Sequencing Analysis Software, Version 5.2 (Applied Biosystem, CA, USA) (ABI 377, Applied Biosystems, Foster City, CA, USA). The ABO genotype of the patient was found to be Aw06/O13.

   Discussion Top

Weaker variants of A and B arise due to inheritance and expression of variant alleles at the ABO locus. They are mostly identified using hemagglutination-based methods. However, due to variation in reagents and techniques used, these weaker phenotypes are often mistyped as O group. If a donor of weaker subgroup is mistyped and labeled as O group and transfused to O group recipients, it may lead to decreased survival of the red cells due to the presence of ABO antibodies in the recipient's serum. Hence, it is important to characterize these weaker subgroups as accurate determination of the ABO type would help in better management of “O” group RBCs and “AB” plasma for transfusion in discrepant cases.[5]

In the present case study, the patient's group was serologically identified as Ax type. The red cells of Ax individuals distinguish themselves by giving negative or weak agglutination by anti-A sera, negative reactions with anti-B sera, but remarkably strong reactions with anti-A, B sera. The Ax phenotype has been associated with many different A variant alleles.[6] The patient's red cells in the present study showed negative reaction with anti-A sera but remarkably strong reaction with anti-A, B. Serum, however, did not show the presence of anti-A1. The molecular genotype was found to be Aw06/O13. This finding is similar to that reported by Seltsam et al., 2002, who found that serological characteristics of RBCs of three patients were similar to subgroup Ax and the serum contained weakly reactive anti-A1. The ABO genotype of all the three patients showed the presence of variant A allele, Aw06.[7]

Aw06 is identical to the reference allele, ABO(*) A101, except for a single-base substitution in exon 7 at position 502, where C was replaced by G causing an amino acid exchange from arginine to glycine at position 168 [Figure 1]. Aw06 has been reported previously in the Indian population and known to cause weak expression of A antigen.[8]
Figure 1: Electropherogram showing 502G>C mutation (heterozygous) identified in the patient A = Adenine, C = Cytosine, G = Guanine, T = Thymine

Click here to view

O13 is deletional O allele which is characterized by single-point mutations 261delG; 297A>G; 646T>A; 681G>A; 771C>T; and 829G>A in exon 6 and 7 of the ABO gene. This allele has been reported at low frequencies in several populations, and interestingly, its frequency increases from north to south for Basques (from France and Spain, 0% ±5% of all O alleles), Berbers (from Morocco, 9%) and Akans (from Ivory Coast, 19%).[9],[10]

   Conclusion Top

Discrepancies in blood typing can be avoided through detailed serological tests and analysis. In the present case, the weak A phenotype having serological characteristics similar to Ax blood type showed the ABO genotype Aw06/O13. Although Aw06 allele has been previously reported in the Indian population, this is the first study to report O13 allele in the Indian population. Molecular genetic approaches help in the correct determination and characterization of weaker ABO subgroups and helps decision making in routine serology.


We would like to thank the study participant and his family for their cooperation in the study.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship


Conflicts of interest

There are no conflicts of interest.

   References Top

Harmening DM, Forneris G, Tubby BJ. The ABO blood group system. In: Harmening D, editor. Modern Blood Banking and Transfusion Practices. PA: F.A Davies Company; 2012.  Back to cited text no. 1
Cartron JP, Gerbal A, Hughes-Jones NC, Salmon C. 'Weak A' phenotypes. Relationship between red cell agglutinability and antigen site density. Immunology 1974;27:723-7.  Back to cited text no. 2
Heier HE, Namork E, Calkovská Z, Sandin R, Kornstad L. Expression of A antigens on erythrocytes of weak blood group A subgroups. Vox Sang 1994;66:231-6.  Back to cited text no. 3
Cai XH, Jin S, Liu X, Shen W, Lu Q, Wang JL, et al. Molecular genetic analysis for the B subgroup revealing two novel alleles in the ABO gene. Transfusion 2008;48:2442-7.  Back to cited text no. 4
Kulkarni S, Gogri H. Molecular concepts in immunohematology. In: Choudhury N, editor. A Textbook on Laboratory and Clinical Transfusion Medicine: Basics of Blood Bank Practices (Process control). Vol. 2. New York: Nova Science Publishers, Inc.; 2017.  Back to cited text no. 5
Patnaik SK, Helmberg W, Blumenfeld OO. BGMUT database of allelic variants of genes encoding human blood group antigens. Transfus Med Hemother 2014;41:346-51.  Back to cited text no. 6
Seltsam A, Hallensleben M, Eiz-Vesper B, Lenhard V, Heymann G, Blasczyk R, et al. Aweak blood group A phenotype caused by a new mutation at the ABO locus. Transfusion 2002;42:294-301.  Back to cited text no. 7
Ray S, Gorakshakar AC, Kashivishwanathan V, Agarwal S, Nadkarni A, Ghosh K, et al. Molecular characterization of weaker variants of A and B in Indian population – The first report. Transfus Apher Sci 2014;50:118-22.  Back to cited text no. 8
Yip SP. Single-tube multiplex PCR-SSCP analysis distinguishes 7 common ABO alleles and readily identifies new alleles. Blood 2000;95:1487-92.   Back to cited text no. 9
Roubinet F, Kermarrec N, Despiau S, Apoil PA, Dugoujon JM, Blancher A,et al. Molecular polymorphism of O alleles in five populations of different ethnic origins. Immunogenetics 2001;53:95-104.  Back to cited text no. 10

Correspondence Address:
Debasish Gupta
Department of Transfusion Medicine, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram, Kerala
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/ajts.AJTS_118_17

Rights and Permissions


  [Figure 1]

  [Table 1]



    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *
* Registration required (free)  

   Case Report
    Article Figures
    Article Tables

 Article Access Statistics
    PDF Downloaded0    
    Comments [Add]    

Recommend this journal

Association Contact us | Sitemap | Advertise | What's New | Feedback | Copyright and Disclaimer

2006 - Asian Journal of Transfusion Science | Published by Wolters Kluwer - Medknow
Online since 10th November, 2006